> 3'UTR Gene: IL12B (NM_002187)

Description: interleukin-12 subunit beta precursor [ Entrez ]
Location: chr5 158674369-158676270    strand: -
miRNA Prediction Algorithms: PicTar 4-wayPicTar 5-wayTargetScandSNP Generated   SNPs: SNPdSNP    [ Show All ]
GTTCTGATCCAGGATGAAAATTTGGAGGAAAAGTGGAAGATATTAAGCAAAATGTTTAAAGACACAACGGAATAGACCCA
AAAAGATAATTTCTATCTGATTTGCTTTAAAACGTTTTTTTAGGATCACAATGATATCTTTGCTGTATTTGTATAGTTAG
ATGCTAAATGCTCATTGAAACAATCAGCTAATTTATGTATAGATTTTCCAGCTCTCAAGTTGCCATGGGCCTTCATGCTA
TTTAAATATTTAAGTAATTTATGTATTTATTAGTATATTACTGTTATTTAACGTTTGTCTGCCAGGATGTATGGAATGTT
TCATACTCTTATGACCTGATCCATCAGGATCAGTCCCTATTATGCAAAATGTGAATTTAATTTTATTTGTACTGACAACT
TTTCAAGCAAGGCTGCAAGTACATCAGTTTTATGACAATCAGGAAGAATGCAGTGTTCTGATACCAGTGCCATCATACAC
TTGTGATGGATGGGAACGCAAGAGATACTTACATGGAAACCTGACAATGCAAACCTGTTGAGAAGATCCAGGAGAACAAG
ATGCTAGTTCCCATGTCTGTGAAGACTTCCTGGAGATGGTGTTGATAAAGCAATTTAGGGCCACTTACACTTCTAAGCAA
GTTTAATCTTTGGATGCCTGAATTTTAAAAGGGCTAGAAAAAAATGATTGACCAGCCTGGGAAACATAACAAGACCCCGT
CTCTACAAAAAAAATTTAAAATTAGCCAGGCGTGGTGGCTCATGCTTGTGGTCCCAGCTGTTCAGGAGGATGAGGCAGGA
GGATCTCTTGAGCCCAGGAGGTCAAGGCTATGGTGAGCCGTGATTGTGCCACTGCATACCAGCCTAGGTGACAGAATGAG
ACCCTGTCTCAAAAAAAAAAATGATTGAAATTAAAATTCAGCTTTAGCTTCCATGGCAGTCCTCACCCCCACCTCTCTAA
AAGACACAGGAGGATGACACAGAAACACCGTAAGTGTCTGGAAGGCAAAAAGATCTTAAGATTCAAGAGAGAGGACAAGT
AGTTATGGCTAAGGACATGAAATTGTCAGAATGGCAGGTGGCTTCTTAACAGCCCTGTGAGAAGCAGACAGATGCAAAGA
AAATCTGGAATCCCTTTCTCATTAGCATGAATGAACCTGATACACAATTATGACCAGAAAATATGGCTCCATGAAGGTGC
TACTTTTAAGTAATGTATGTGCGCTCTGTAAAGTGATTACATTTGTTTCCTGTTTGTTTATTTATTTATTTATTTTTGCA
TTCTGAGGCTGAACTAATAAAAACTCTTCTTTGTAATC